OutbreakIndividualMalariaGenetics
The OutbreakIndividualMalariaGenetics intervention class is an individual-level intervention that extends the parameter-campaign-individual-outbreakindividual class by adding the ability to specify parasite genetics for the infection. This class is only used when the configuration parameter Malaria_Model is set to MALARIA_MECHANISTIC_MODEL_WITH_PARASITE_GENETICS.
Seealso
malaria-model-fpg For the full FPG workflow, including genome configuration, seeding modes, recombination, and output reports.
The parameter Create_Nucleotide_Sequence_From (see table below) determines how the parasite genetics are defined.
Note
Parameters are case-sensitive. For Boolean parameters, set to 1 for true or 0 for false. Minimum, maximum, or default values of "NA" indicate that those values are not applicable for that parameter.
EMOD does not use true defaults; that is, if the dependency relationships indicate that a parameter is required, you must supply a value for it. However, many of the tools used to work with EMOD will use the default values provided below.
JSON format does not permit comments, but you can add "dummy" parameters to add contextual information to your files. Any keys that are not EMOD parameter names will be ignored by the model.
The table below describes all possible parameters with which this class can be configured. The JSON example that follows shows one potential configuration.
| Parameter | Type | Min | Max | Default | Description |
|---|---|---|---|---|---|
| Barcode_Allele_Frequencies_Per_Genome_Location | array of floats | 0 | 1 | [] | The fractions of allele occurrences for each location in the barcode. This 2D array has an inner array for each location in the barcode. The number of inner arrays depends on the number of locations defined in the Parasite_Genetics configuration parameter Barcode_Genome_Locations. Each inner array should have four values for the frequency of each allele at that location. The position of the value in the inner array determines the allele: index 0 is A, index 1 is C, index 2 is G, and index 3 is T. Required when Create_Nucleotide_Squence_From is set to 'ALLELE_FREQUENCIES'. |
| Barcode_String | string | NA | NA | UNINITIALIZED STRING | A series of nucleotide base letters (A, C, G, T) that represent the values at locations in the genome. The length of the string depends on the number of locations defined in the Parasite_Genetics configuration parameter Barcode_Genome_Locations. Each character of the string corresponds to one of the locations, and locations are assumed to be in ascending order. Required when Create_Nucleotide_Sequence_From is set to 'NUCLEOTIDE_SEQUENCE' or 'BARCODE_STRING'. |
| Create_Nucleotide_Sequence_From | enum | NA | NA | BARCODE_STRING | The enum indicates how the genome is created. Possible values are: BARCODE_STRING This option allows the user to specify a genome via the barcode. The barcode provided will set the values of the barcode locations and the rest of the locations will depend on the Parasite_Genetics configuration parameter Var_Gene_Randomness_Type setting. If the setting is FIXED_MSP or FIXED_NEIGHBORHOOD, then the barcode will be used to set where in the variant range the MSP and PfEMP1 values will come from. It is assumed that if a person has had an infection with a particular barcode, then it is likely that they have antibodies to fight a new infection with the same barcode. It is necessary to have multiple distributions of this intervention with different barcode strings in order to get infection diversity. ALLELE_FREQUENCIES This option allows the user to specify that each new infection from this outbreak will have a its genome created using the frequencies defined in the Barcode_Allele_Frequencies_Per_Genome_Location parameters. This is like selecting a delay time from a distribution and allows random creation of new genomes. However, after the outbreak, new genomes are only created via meiosis and recombination. NUCLEOTIDE_SEQUENCE This option allows the user to specify the entire nucleotide sequence including the MSP and major epitope values. |
| Drug_Resistant_Allele_Frequencies_Per_Genome_Location | array of floats | 0 | 1 | [] | The fractions of allele occurrences for each location in the barcode. This 2D array has an inner array for each location in the barcode. The number of inner arrays depends on the number of locations defined in the Parasite_Genetics configuration parameter Drug_Resistant_Genome_Locations. Each inner array should have four values for the frequency of each allele at that location. The position of the value in the inner array determines the allele: index 0 is A, index 1 is C, index 2 is G, and index 3 is T. Required when Create_Nucleotide_Squence_From is set to 'ALLELE_FREQUENCIES'. |
| Drug_Resistant_String | string | NA | NA | "" | A series of nucleotide base letters (A, C, G, T) that represent the values at locations in the genome. The length of the string depends on the number of locations defined in the Parasite_Genetics configuration parameter Drug_Resistant_Genome_Locations. Each character of the string corresponds to one of the locations, and locations are assumed to be in ascending order. Required when Create_Nucleotide_Sequence_From is set to 'NUCLEOTIDE_SEQUENCE' or 'BARCODE_STRING'. |
| HRP_Allele_Frequencies_Per_Genome_Location | array of floats | 0 | 1 | [] | The fractions of allele occurrences for each location in the barcode. This 2D array has an inner array for each location in the barcode. The number of inner arrays depends on the number of locations defined in the Parasite_Genetics configuration parameter HRP_Genome_Locations. Each inner array should have four values for the frequency of each allele at that location. The position of the value in the inner array determines the allele: index 0 is A, index 1 is C, index 2 is G, and index 3 is T. Required when Create_Nucleotide_Squence_From is set to 'ALLELE_FREQUENCIES'. |
| HRP_String | string | NA | NA | "" | A series of nucleotide base letters (A, C, G, T) that represent the HRP values at locations in the genome. The length of the string depends on the number of locations defined in the Parasite_Genetics configuration parameter HRP_Genome_Locations. 'A' means HRP marker is not present and a non-'A' means it is. Required when Create_Nucleotide_Sequence_From is set to 'NUCLEOTIDE_SEQUENCE' or 'BARCODE_STRING'. |
| Ignore_Immunity | boolean | 0 | 1 | 1 | Individuals will be force-infected (with a specific strain) regardless of actual immunity level when set to true (1). |
| Incubation_Period_Override | integer | -1 | 2.14E+09 | -1 | The incubation period, in days, that infected individuals will go through before becoming infectious. This value overrides the incubation period set in the configuration file. Set to -1 to honor the configuration parameter settings. |
| MSP_Variant_Value | integer | 0 | 1000 | NA | The Merozoite Surface Protein value used to determine how the antibodies recognize the merozoites. This value must be less than or equal to the value for the configuration parameter Falciparum_MSP_Variants and is required when Create_Nucleotide_Sequence_From is set to 'NUCLEOTIDE_SEQUENCE'. |
| PfEMP1_Variants_Values | array of integers | 0 | 10000 | [] | The PfEMP1 Variant values/major epitopes used to define how the antibodies recognize the infected red blood cells. Each value in the array must be less than or equal to the value for the configuration parameter Falciparum_PfEMP1_Variants and is required when Create_Nucleotide_Sequence_From is set to 'NUCLEOTIDE_SEQUENCE'. Note: The array must contain 50 values. |
{
"class": "OutbreakIndividualMalariaGenetics",
"Create_Nucleotide_Squence_From": "BARCODE_STRING",
"Barcode_String": "ACGTACGTACGTACGTACGTACGT",
"Drug_Resistant_String": "AAT"
}
{
"class": "OutbreakIndividualMalariaGenetics",
"Create_Nucleotide_Squence_From": "ALLELE_FREQUENCIES",
"Barcode_Allele_Frequencies_Per_Genome_Location": [
[1.0, 0.0, 0.0, 0.0],
[0.0, 1.0, 0.0, 0.0],
[0.0, 0.0, 1.0, 0.0],
[0.0, 0.0, 0.0, 1.0],
[0.5, 0.5, 0.0, 0.0],
[0.0, 0.5, 0.5, 0.0],
[0.0, 0.0, 0.5, 0.5],
[0.25, 0.25, 0.25, 0.25],
[0.1, 0.2, 0.3, 0.4],
[0.4, 0.3, 0.2, 0.1]
],
"Drug_Resistant_Allele_Frequencies_Per_Genome_Location": [
[1.0, 0.0, 0.0, 0.0],
[0.0, 1.0, 0.0, 0.0],
[0.0, 0.0, 1.0, 0.0]
]
}
{
"class": "OutbreakIndividualMalariaGenetics",
"Create_Nucleotide_Squence_From": "NUCLEOTIDE_SEQUENCE",
"Barcode_String": "ACGTACGTACGTACGTACGTACGT",
"Drug_Resistant_String": "AAT",
"MSP_Variant_Value": 11,
"PfEMP1_Variants_Values": [
1, 74, 147, 220, 293, 366, 439, 512, 585, 658,
731, 804, 877, 950, 23, 96, 169, 242, 315, 388,
461, 534, 607, 680, 753, 826, 899, 972, 45, 118,
191, 264, 337, 410, 483, 556, 629, 702, 775, 848,
921, 994, 67, 140, 213, 286, 359, 432, 505, 578
]
}